Human MOSC1 (MARC1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MTARC1
Locus ID	64757
Kit Components	GA112123G1, MOSC1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGCTCAGCTTCCACTTGGT GA112123G2, MOSC1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAGGACGCACTGCTCTGAT GA112123G3, MOSC1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCAGGAGCTGCCCAGCCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_022746
Synonyms	MOSC1
Summary	As a component of an N-hydroxylated prodrug-converting complex required to reduce N-hydroxylated prodrugs, such as benzamidoxime. Also able to reduce N(omega)-hydroxy-L-arginine (NOHA) and N(omega)-hydroxy-N(delta)-methyl-L-arginine (NHAM) into L-arginine and N(delta)-methyl-L-arginine, respectively.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.