Human PRDM16 activation kit by CRISPRa
CAT#: GA111942
PRDM16 CRISPRa kit - CRISPR gene activation of human PR/SET domain 16
CNY 12255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | PRDM16 |
Locus ID | 63976 |
Kit Components | GA111942G1, PRDM16 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCACCCCGGACACTTTAAA GA111942G2, PRDM16 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAATCTGACACCCCTCGCCG GA111942G3, PRDM16 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGTCCAAACTGACAATGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_022114, NM_199454 |
Synonyms | CMD1LL; LVNC8; MEL1; PFM13 |
Summary | The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN411534 | PRDM16 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |