Human SLC41A3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SLC41A3
Locus ID	54946
Kit Components	GA110393G1, SLC41A3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTATAAGTGGCACGTGCTA GA110393G2, SLC41A3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGACCCTATGGAGACACC GA110393G3, SLC41A3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGGCAAAGCCTCGAGCAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001008485, NM_001008486, NM_001008487, NM_001164475, NM_017836
Synonyms	SLC41A1-L2

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.