Human TRIAD3 (RNF216) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	RNF216
Locus ID	54476
Kit Components	GA110126G1, TRIAD3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTCACCCTCCTGCCTCGTG GA110126G2, TRIAD3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACTAGGCGGCCCTCTCTA GA110126G3, TRIAD3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGAGGCACTCCGGGTACTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_019011, NM_207111, NM_207116
Synonyms	U7I1; UBCE7IP1; ZIN
Summary	This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.