Human FOXP3 activation kit by CRISPRa
CAT#: GA109480
FOXP3 CRISPRa kit - CRISPR gene activation of human forkhead box P3
CNY 12,255.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | FOXP3 |
Locus ID | 50943 |
Kit Components | GA109480G1, FOXP3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAATCACAGGGCCAACCCG GA109480G2, FOXP3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATTTTCAGATGACTCGTAA GA109480G3, FOXP3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAGTCTCATAATCAAGAAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001114377, NM_014009 |
Synonyms | AIID; DIETER; IPEX; JM2; PIDX; XPID |
Summary | The protein encoded by this gene is a member of the forkhead/winged-helix family of transcriptional regulators. Defects in this gene are the cause of immunodeficiency polyendocrinopathy, enteropathy, X-linked syndrome (IPEX), also known as X-linked autoimmunity-immunodeficiency syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN217580 | FOXP3 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN217580BN | FOXP3 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN217580LP | FOXP3 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN217580RB | FOXP3 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN417580 | FOXP3 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |