Human ST6GALNAC6 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ST6GALNAC6
Locus ID	30815
Kit Components	GA109385G1, ST6GALNAC6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAGCTACTCAGTAGGCTG GA109385G2, ST6GALNAC6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAGTCTCACTCTGTCGCCC GA109385G3, ST6GALNAC6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTCGGCCTCCCAAAGTGCT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001286999, NM_001287000, NM_001287001, NM_001287002, NM_001287003, NM_013443, NR_104629
Synonyms	SIAT7-F; SIAT7F; ST6GALNACVI
Summary	ST6GALNAC6 belongs to a family of sialyltransferases that modify proteins and ceramides on the cell surface to alter cell-cell or cell-extracellular matrix interactions (Tsuchida et al., 2003 [PubMed 12668675]).[supplied by OMIM, Mar 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.