Human RAB18 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	RAB18
Locus ID	22931
Kit Components	GA107922G1, RAB18 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCCTCCCACTGACTCAAA GA107922G2, RAB18 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCTACCTCAAGGCGGAAC GA107922G3, RAB18 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCTTTCACACCGGGTGTTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001256410, NM_001256411, NM_001256412, NM_001256415, NM_021252, NR_046172, N56901
Synonyms	RAB18LI1; WARBM3
Summary	The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.