Human DNA Polymerase theta (POLQ) activation kit by CRISPRa
CAT#: GA107345
POLQ CRISPRa kit - CRISPR gene activation of human DNA polymerase theta
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | POLQ |
| Locus ID | 10721 |
| Kit Components | GA107345G1, DNA Polymerase theta gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTCATATTAACCAACCAGG GA107345G2, DNA Polymerase theta gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCGAAAGCCATAGACTCGT GA107345G3, DNA Polymerase theta gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACGGAGAACTCTATGGTTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_006596, NM_199420 |
| Synonyms | DKFZp781A0112; DNA polymerase eta; DNA polymerase theta; POLH; POLH, PRO0327, DKFZp781A0112; polymerase (DNA directed), theta; PRO0327 |
| Summary | DNA polymerase that promotes microhomology-mediated end-joining (MMEJ), an alternative non-homologous end-joining (NHEJ) machinery triggered in response to double-strand breaks in DNA (PubMed:25642963, PubMed:25643323). MMEJ is an error-prone repair pathway that produces deletions of sequences from the strand being repaired and promotes genomic rearrangements, such as telomere fusions, some of them leading to cellular transformation (PubMed:25642963, PubMed:25643323). POLQ acts as an inhibitor of homology-recombination repair (HR) pathway by limiting RAD51 accumulation at resected ends (PubMed:25642963). POLQ-mediated MMEJ may be required to promote the survival of cells with a compromised HR repair pathway, thereby preventing genomic havoc by resolving unrepaired lesions (By similarity). The polymerase acts by binding directly the 2 ends of resected double-strand breaks, allowing microhomologous sequences in the overhangs to form base pairs. It then extends each strand from the base-paired region using the opposing overhang as a template. Requires partially resected DNA containing 2 to 6 base pairs of microhomology to perform MMEJ (PubMed:25643323). The polymerase activity is highly promiscuous: unlike most polymerases, promotes extension of ssDNA and partial ssDNA (pssDNA) substrates (PubMed:18503084, PubMed:21050863, PubMed:22135286). Also exhibits low-fidelity DNA synthesis, translesion synthesis and lyase activity, and it is implicated in interstrand-cross-link repair, base excision repair and DNA end-joining (PubMed:14576298, PubMed:18503084, PubMed:19188258, PubMed:24648516). Involved in somatic hypermutation of immunoglobulin genes, a process that requires the activity of DNA polymerases to ultimately introduce mutations at both A/T and C/G base pairs (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN212566 | POLQ - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN212566BN | POLQ - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN212566LP | POLQ - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN212566RB | POLQ - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN412566 | POLQ - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
