Human MAP4K4 activation kit by CRISPRa
CAT#: GA106309
MAP4K4 CRISPRa kit - CRISPR gene activation of human mitogen-activated protein kinase kinase kinase kinase 4
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | MAP4K4 |
| Locus ID | 9448 |
| Kit Components | GA106309G1, MAP4K4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTGTGAGTGCGTTTCCGC GA106309G2, MAP4K4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTCCTGCCTGAGGAGGAA GA106309G3, MAP4K4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCCTCCGCCTCCGCCTCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001242559, NM_001242560, NM_004834, NM_145686, NM_145687 |
| Synonyms | FLH21957; HEL-S-31; HGK; MEKKK4; NIK |
| Summary | The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN415163 | MAP4K4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
