Human DRAK1 (STK17A) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	STK17A
Locus ID	9263
Kit Components	GA106179G1, DRAK1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGACTCTCAGACGCTCAAC GA106179G2, DRAK1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTAACGCAGTAGGCTGTCC GA106179G3, DRAK1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACTCACAGCACCACCCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_004760
Synonyms	DRAK1
Summary	This gene is a member of the DAP kinase-related apoptosis-inducing protein kinase family and encodes an autophosphorylated nuclear protein with a protein kinase domain. The protein has apoptosis-inducing activity. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.