Human PKMYT1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PKMYT1
Locus ID	9088
Kit Components	GA106049G1, PKMYT1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTAGTGTTTGGGTCCATAAA GA106049G2, PKMYT1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGGACGCCCACTGCCCTCC GA106049G3, PKMYT1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACCCCTGACGGGCTGCACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001258450, NM_001258451, NM_004203, NM_182687
Synonyms	MYT1; PPP1R126
Summary	This gene encodes a member of the serine/threonine protein kinase family. The encoded protein is a membrane-associated kinase that negatively regulates the G2/M transition of the cell cycle by phosphorylating and inactivating cyclin-dependent kinase 1. The activity of the encoded protein is regulated by polo-like kinase 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.