Human TNFSF9 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TNFSF9
Locus ID	8744
Kit Components	GA105808G1, TNFSF9 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGCGGAATTTTCTCCACT GA105808G2, TNFSF9 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAATTCCGCAGAGTCACG GA105808G3, TNFSF9 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCTGCTTGGCTACAAAAGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_003811
Synonyms	4-1BB-L; CD137L; TNLG5A
Summary	The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This transmembrane cytokine is a bidirectional signal transducer that acts as a ligand for TNFRSF9/4-1BB, which is a costimulatory receptor molecule in T lymphocytes. This cytokine and its receptor are involved in the antigen presentation process and in the generation of cytotoxic T cells. The receptor TNFRSF9/4-1BB is absent from resting T lymphocytes but rapidly expressed upon antigenic stimulation. The ligand encoded by this gene, TNFSF9/4-1BBL, has been shown to reactivate anergic T lymphocytes in addition to promoting T lymphocyte proliferation. This cytokine has also been shown to be required for the optimal CD8 responses in CD8 T cells. This cytokine is expressed in carcinoma cell lines, and is thought to be involved in T cell-tumor cell interaction.[provided by RefSeq, Oct 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.