Human TNFSF9 activation kit by CRISPRa
CAT#: GA105808
TNFSF9 CRISPRa kit - CRISPR gene activation of human TNF superfamily member 9
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 3600.00
CNY 3705.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | TNFSF9 |
| Locus ID | 8744 |
| Kit Components | GA105808G1, TNFSF9 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGCGGAATTTTCTCCACT GA105808G2, TNFSF9 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAATTCCGCAGAGTCACG GA105808G3, TNFSF9 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCTGCTTGGCTACAAAAGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_003811 |
| Synonyms | 4-1BB-L; CD137L; TNLG5A |
| Summary | The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This transmembrane cytokine is a bidirectional signal transducer that acts as a ligand for TNFRSF9/4-1BB, which is a costimulatory receptor molecule in T lymphocytes. This cytokine and its receptor are involved in the antigen presentation process and in the generation of cytotoxic T cells. The receptor TNFRSF9/4-1BB is absent from resting T lymphocytes but rapidly expressed upon antigenic stimulation. The ligand encoded by this gene, TNFSF9/4-1BBL, has been shown to reactivate anergic T lymphocytes in addition to promoting T lymphocyte proliferation. This cytokine has also been shown to be required for the optimal CD8 responses in CD8 T cells. This cytokine is expressed in carcinoma cell lines, and is thought to be involved in T cell-tumor cell interaction.[provided by RefSeq, Oct 2008] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN411160 | TNFSF9 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
