Human Apolipoprotein L 1 (APOL1) activation kit by CRISPRa
CAT#: GA105656
APOL1 CRISPRa kit - CRISPR gene activation of human apolipoprotein L1
CNY 12255.00
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | APOL1 |
| Locus ID | 8542 |
| Kit Components | GA105656G1, Apolipoprotein L 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACCTGCCACTGACATACTA GA105656G2, Apolipoprotein L 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAATTCCTCGGTATATCTTG GA105656G3, Apolipoprotein L 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGTCCCCAAGATATACCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001136540, NM_001136541, NM_003661, NM_145343, NM_145344, NM_001362927 |
| Synonyms | APO-L; APOL; APOL-I; FSGS4 |
| Summary | This gene encodes a secreted high density lipoprotein which binds to apolipoprotein A-I. Apolipoprotein A-I is a relatively abundant plasma protein and is the major apoprotein of HDL. It is involved in the formation of most cholesteryl esters in plasma and also promotes efflux of cholesterol from cells. This apolipoprotein L family member may play a role in lipid exchange and transport throughout the body, as well as in reverse cholesterol transport from peripheral cells to the liver. Several different transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN411114 | APOL1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
