Human KMT2D activation kit by CRISPRa
CAT#: GA105405
KMT2D CRISPRa kit - CRISPR gene activation of human lysine methyltransferase 2D
CNY 12255.00
Cited in 1 publication. |
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | KMT2D |
Locus ID | 8085 |
Kit Components | GA105405G1, KMT2D gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCTTCCATCCCCCTCCC GA105405G2, KMT2D gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCGCCTCATTTACCGCCC GA105405G3, KMT2D gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCCGCGAAACTAGGACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_003482 |
Synonyms | AAD10; ALR; CAGL114; KABUK1; KMS; MLL2; MLL4; TNRC21 |
Summary | The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010] |
Citations (1)
The use of this Gene Expression has been cited in the following citations: |
---|
MLL4 Regulates the Progression of Non–Small-Cell Lung Cancer by Regulating the PI3K/AKT/SOX2 Axis
,null,
Cancer Research and Treatment : Official Journal of Korean Cancer Association
,PubMed ID 36701842
[KMT2D]
|
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN421064 | KMT2D - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |