Human Titin (TTN) activation kit by CRISPRa

CAT#: GA105007

TTN CRISPRa kit - CRISPR gene activation of human titin



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol TTN
Locus ID 7273
Kit Components

GA105007G1, Titin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTATGTGACACTACCAAAT

GA105007G2, Titin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTAAGACAGCCAATCACCC

GA105007G3, Titin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATCTGGTGAATATAAGGGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001256850, NM_001267550, NM_003319, NM_133378, NM_133379, NM_133432, NM_133437
Synonyms CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J; MYLK5; TMD
Summary This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...