Human Cardiac Troponin T (TNNT2) activation kit by CRISPRa
CAT#: GA104931
TNNT2 CRISPRa kit - CRISPR gene activation of human troponin T2, cardiac type
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 2400.00
CNY 3990.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | TNNT2 |
Locus ID | 7139 |
Kit Components | GA104931G1, Cardiac Troponin T gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGACCACATGGGCTTATA GA104931G2, Cardiac Troponin T gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACGCCATATAAGCCCATG GA104931G3, Cardiac Troponin T gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGCCAGGGACAAGGCTAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_000364, NM_001001430, NM_001001431, NM_001001432, NM_001276345, NM_001276346, NM_001276347 |
Synonyms | CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC |
Summary | The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN401218 | TNNT2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |