Human SREBP2 (SREBF2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SREBF2
Locus ID	6721
Kit Components	GA104619G1, SREBP2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGAAGCGGTGCGTGGGGTGA GA104619G2, SREBP2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAATGCCTGGAGTAGCCGTC GA104619G3, SREBP2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCACCGCTTCGCTCGCCCAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_004599, NR_103834
Synonyms	bHLHd2; SREBP-2; SREBP2
Summary	This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.