Human SREBP1 (SREBF1) activation kit by CRISPRa
CAT#: GA104618
SREBF1 CRISPRa kit - CRISPR gene activation of human sterol regulatory element binding transcription factor 1
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | SREBF1 |
| Locus ID | 6720 |
| Kit Components | GA104618G1, SREBP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAGATTTGTGGCGCAGACC GA104618G2, SREBP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGGGCCGTCTATCTGGGA GA104618G3, SREBP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAATGGCAGCGGCCTCTGGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001005291, NM_001321096, NM_004176 |
| Synonyms | bHLHd1; SREBP-1c; SREBP1; SREBP1a |
| Summary | This gene encodes a basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a motif that is found in the promoter of the low density lipoprotein receptor gene and other genes involved in sterol biosynthesis. The encoded protein is synthesized as a precursor that is initially attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription. This cleaveage is inhibited by sterols. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternative promoter usage and splicing result in multiple transcript variants, including SREBP-1a and SREBP-1c, which correspond to RefSeq transcript variants 2 and 3, respectively. [provided by RefSeq, Nov 2017] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN408404 | SREBF1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |

