Human SRD5A2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SRD5A2
Locus ID	6716
Kit Components	GA104615G1, SRD5A2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTACTCTGTTGCCCAGGC GA104615G2, SRD5A2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCCACAAATGTTAGAGGC GA104615G3, SRD5A2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTACCCTTCAGGCCAACCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000348
Synonyms	MGC138457
Summary	This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.