Human Kallikrein 6 (KLK6) activation kit by CRISPRa
CAT#: GA103832
KLK6 CRISPRa kit - CRISPR gene activation of human kallikrein related peptidase 6
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | KLK6 |
| Locus ID | 5653 |
| Kit Components | GA103832G1, Kallikrein 6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAAAGGAGGACTGTCAGAC GA103832G2, Kallikrein 6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCCTCAACCTCTCTTCCGG GA103832G3, Kallikrein 6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACAAAGCCCGATTGTTCCT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001012964, NM_001012965, NM_001012966, NM_001319948, NM_001319949, NM_002774 |
| Synonyms | Bssp; hK6; Klk7; PRSS9; PRSS18; SP59 |
| Summary | This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN402146 | KLK6 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
