Human EXOSC10 activation kit by CRISPRa

CAT#: GA103633

EXOSC10 CRISPRa kit - CRISPR gene activation of human exosome component 10



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

推荐一起购买 (3)
EXOSC10 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


EXOSC10 (Myc-DDK-tagged)-Human exosome component 10 (EXOSC10), transcript variant 1
    • 10 ug

CNY 6480.00


EXOSC10 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol EXOSC10
Locus ID 5394
Kit Components

GA103633G1, EXOSC10 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCTTCCCAACCTAATCGC

GA103633G2, EXOSC10 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGTGCCCCACCCTAAACGC

GA103633G3, EXOSC10 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAGTGCCACCCTAATCGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001001998, NM_002685
Synonyms p2; p3; p4; PM-Scl; PM/Scl-100; PMSCL; PMSCL2; RRP6; Rrp6p
Summary Putative catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. EXOSC10 has 3'-5' exonuclease activity (By similarity). EXOSC10 is required for nucleolar localization of C1D and probably mediates the association of MTREX, C1D and MPP6 wth the RNA exosome involved in the maturation of 5.8S rRNA.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...