Human EXOSC10 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	EXOSC10
Locus ID	5394
Kit Components	GA103633G1, EXOSC10 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCTTCCCAACCTAATCGC GA103633G2, EXOSC10 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGTGCCCCACCCTAAACGC GA103633G3, EXOSC10 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAGTGCCACCCTAATCGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001001998, NM_002685
Synonyms	p2; p3; p4; PM-Scl; PM/Scl-100; PMSCL; PMSCL2; RRP6; Rrp6p
Summary	Putative catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. EXOSC10 has 3'-5' exonuclease activity (By similarity). EXOSC10 is required for nucleolar localization of C1D and probably mediates the association of MTREX, C1D and MPP6 wth the RNA exosome involved in the maturation of 5.8S rRNA.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.