Human Perilipin-1 (PLIN1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PLIN1
Locus ID	5346
Kit Components	GA103605G1, Perilipin-1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATACTAAGTCCTCTGAGCC GA103605G2, Perilipin-1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTCATATAACCATGACAAC GA103605G3, Perilipin-1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAACAATTCCTGTCACTCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001145311, NM_002666
Synonyms	FPLD4; PERI; PLIN
Summary	The protein encoded by this gene coats lipid storage droplets in adipocytes, thereby protecting them until they can be broken down by hormone-sensitive lipase. The encoded protein is the major cAMP-dependent protein kinase substrate in adipocytes and, when unphosphorylated, may play a role in the inhibition of lipolysis. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Feb 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.