Human Polycystin 1 (PKD1) activation kit by CRISPRa
CAT#: GA103572
PKD1 CRISPRa kit - CRISPR gene activation of human polycystin 1, transient receptor potential channel interacting
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | PKD1 |
| Locus ID | 5310 |
| Kit Components | GA103572G1, Polycystin 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCGATGAGGGACTGGCATC GA103572G2, Polycystin 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACCCTCCGCTCCACAGGGT GA103572G3, Polycystin 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCCCGTCGCACTGTAGAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_000296, NM_001009944 |
| Synonyms | PBP; Pc-1; TRPP1 |
| Summary | This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN415081 | PKD1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
