Human CD229 (LY9) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	LY9
Locus ID	4063
Kit Components	GA102757G1, CD229 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGTGTGTGTCTCAGAGGGA GA102757G2, CD229 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCTACCTGCCTGCGCAGAT GA102757G3, CD229 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGCAGATGGGAGGAGTCTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001033667, NM_001261456, NM_001261457, NM_002348
Synonyms	CD229; hly9; mLY9; SLAMF3
Summary	LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]).[supplied by OMIM, Mar 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.