Human Lipoprotein a (LPA) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	LPA
Locus ID	4018
Kit Components	GA102725G1, Lipoprotein a gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAGGAAACAAGACTAATC GA102725G2, Lipoprotein a gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTGCAATGTCAATAGATGC GA102725G3, Lipoprotein a gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTATAAGACTCTATATTCA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_005577
Synonyms	AK38; APOA; LP
Summary	The protein encoded by this gene is a serine proteinase that inhibits the activity of tissue-type plasminogen activator I. The encoded protein constitutes a substantial portion of lipoprotein(a) and is proteolytically cleaved, resulting in fragments that attach to atherosclerotic lesions and promote thrombogenesis. Elevated plasma levels of this protein are linked to atherosclerosis. Depending on the individual, the encoded protein contains 2-43 copies of kringle-type domains. The allele represented here contains 15 copies of the kringle-type repeats and corresponds to that found in the reference genome sequence. [provided by RefSeq, Dec 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.