Human Insulin (INS) activation kit by CRISPRa
CAT#: GA102433
INS CRISPRa kit - CRISPR gene activation of human insulin
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | INS |
| Locus ID | 3630 |
| Kit Components | GA102433G1, Insulin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGCACCAGGGAAATGGTC GA102433G2, Insulin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTTGAGAGGTAGGGGAGA GA102433G3, Insulin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCGTCAGCACCTCTTCCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_000207, NM_001185097, NM_001185098, NM_001291897 |
| Synonyms | IDDM; IDDM1; IDDM2; ILPR; IRDN; MODY10 |
| Summary | This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified, including insulin-dependent diabetes mellitus, permanent neonatal diabetes diabetes mellitus, maturity-onset diabetes of the young type 10 and hyperproinsulinemia. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. [provided by RefSeq, May 2020] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN402701 | INS - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
