Human IL12B activation kit by CRISPRa

CAT#: GA102402

IL12B CRISPRa kit - CRISPR gene activation of human interleukin 12B



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

推荐一起购买 (3)
IL12B mouse monoclonal antibody, clone OTI1A3 (formerly 1A3)
    • 100 ul

CNY 1999.00
CNY 2700.00


IL12B (Myc-DDK-tagged)-Human interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40) (IL12B)
    • 10 ug

CNY 2400.00
CNY 3990.00


IL12B mouse monoclonal antibody, clone OTI3H6 (formerly 3H6)
    • 30 ul

CNY 800.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol IL12B
Locus ID 3593
Kit Components

GA102402G1, IL12B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCCTTCTTCCTCGATCTG

GA102402G2, IL12B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGGGAATAAGGAAGGAGA

GA102402G3, IL12B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGTGCTTGGAGACAGCACT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_002187
Synonyms CLMF; CLMF2; IL-12B; IMD28; IMD29; NKSF; NKSF2
Summary This gene encodes a subunit of interleukin 12, a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. This cytokine is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...