Human Tenascin C (TNC) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TNC
Locus ID	3371
Kit Components	GA102293G1, Tenascin C gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTTCACTAACAGCTACTCG GA102293G2, Tenascin C gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGAAAGACGCACTCACTCC GA102293G3, Tenascin C gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTATATAAGCCAGCCAAAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_002160
Synonyms	150-225; DFNA56; GMEM; GP; HXB; JI; TN; TN-C
Summary	This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.