Human GBA activation kit by CRISPRa
CAT#: GA101750
GBA CRISPRa kit - CRISPR gene activation of human glucosylceramidase beta
CNY 12255.00
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | GBA |
Locus ID | 2629 |
Kit Components | GA101750G1, GBA gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGAACGAACAAGTGTCGC GA101750G2, GBA gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCCTTCCTCAAGTCTCAT GA101750G3, GBA gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGACGGTCACTCATGCAG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812 |
Synonyms | GBA1; GCB; GLUC |
Summary | This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN201614 | GBA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201614BN | GBA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201614LP | GBA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201614RB | GBA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN401614 | GBA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |