Human FUT2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FUT2
Locus ID	2524
Kit Components	GA101673G1, FUT2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCCCCAAGGAAGACCCTCG GA101673G2, FUT2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAAGGTCGCATCCCCCATC GA101673G3, FUT2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGGACTTTGTGGCCGGCAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000511, NM_001097638
Synonyms	B12QTL1; SE; Se2; SEC2; sej
Summary	The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the soluble A and B antigen synthesis pathway. This gene is one of two encoding the galactoside 2-L-fucosyltransferase enzyme. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.