Human Filamin B (FLNB) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FLNB
Locus ID	2317
Kit Components	GA101626G1, Filamin B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGCCCGACCCATTCTGTC GA101626G2, Filamin B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTAGGGCTGCCTGAATCACC GA101626G3, Filamin B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGAAGCCCACCACCCCAGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001164317, NM_001164318, NM_001164319, NM_001457
Synonyms	ABP-278; ABP-280; AOI; FH1; FLN-B; FLN1L; LRS1; SCT; TABP; TAP
Summary	This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.