Human Fc epsilon RI (FCER1A) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FCER1A
Locus ID	2205
Kit Components	GA101543G1, Fc epsilon RI gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATCAAATACTGAACCATAC GA101543G2, Fc epsilon RI gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGCTTCTGACCTTGGCAAT GA101543G3, Fc epsilon RI gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTTTTAAAGATCACTATC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_002001
Synonyms	FCE1A; FcERI
Summary	The immunoglobulin epsilon receptor (IgE receptor) is the initiator of the allergic response. When two or more high-affinity IgE receptors are brought together by allergen-bound IgE molecules, mediators such as histamine that are responsible for allergy symptoms are released. This receptor is comprised of an alpha subunit, a beta subunit, and two gamma subunits. The protein encoded by this gene represents the alpha subunit. [provided by RefSeq, Aug 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.