Human Fatty Acid Binding Protein 5 (FABP5) activation kit by CRISPRa
CAT#: GA101514
FABP5 CRISPRa kit - CRISPR gene activation of human fatty acid binding protein 5
CNY 12255.00
CNY 1200.00
CNY 3705.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | FABP5 |
Locus ID | 2171 |
Kit Components | GA101514G1, Fatty Acid Binding Protein 5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGTCAAACGGAGGGGTGC GA101514G2, Fatty Acid Binding Protein 5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGTCAAACGGAGGGGTGC GA101514G3, Fatty Acid Binding Protein 5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTATGCGGCCAATGGGAGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_001444 |
Synonyms | E-FABP; EFABP; KFABP; PA-FABP; PAFABP |
Summary | This gene encodes the fatty acid binding protein found in epidermal cells, and was first identified as being upregulated in psoriasis tissue. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABPs may play roles in fatty acid uptake, transport, and metabolism. Polymorphisms in this gene are associated with type 2 diabetes. The human genome contains many pseudogenes similar to this locus.[provided by RefSeq, Feb 2011] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN401973 | FABP5 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |