Human EZH2 activation kit by CRISPRa
CAT#: GA101494
EZH2 CRISPRa kit - CRISPR gene activation of human enhancer of zeste 2 polycomb repressive complex 2 subunit
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 8248.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | EZH2 |
| Locus ID | 2146 |
| Kit Components | GA101494G1, EZH2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCGGGCCCTGTGATTGGAC GA101494G2, EZH2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGTGCGCTCAGGGCTCGT GA101494G3, EZH2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCGCTGTAAGGGACGCCAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001203247, NM_001203248, NM_001203249, NM_004456, NM_152998 |
| Synonyms | ENX-1; ENX1; EZH1; EZH2b; KMT6; KMT6A; WVS; WVS2 |
| Summary | This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN202054 | EZH2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202054BN | EZH2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202054LP | EZH2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202054RB | EZH2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN402054 | EZH2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
