Human CD26 (DPP4) activation kit by CRISPRa
CAT#: GA101256
DPP4 CRISPRa kit - CRISPR gene activation of human dipeptidyl peptidase 4
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 800.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | DPP4 |
Locus ID | 1803 |
Kit Components | GA101256G1, CD26 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGTCATTTTTAGCTAAG GA101256G2, CD26 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCCGTGGGGGAGGGGAAA GA101256G3, CD26 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACCTCACGTGGACAGGCGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_001935 |
Synonyms | ADABP; ADCP2; CD26; DPPIV; TP103 |
Summary | The DPP4 gene encodes dipeptidyl peptidase 4, which is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic type II transmembrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. Dipeptidyl peptidase 4 is highly involved in glucose and insulin metabolism, as well as in immune regulation. This protein was shown to be a functional receptor for Middle East respiratory syndrome coronavirus (MERS-CoV), and protein modeling suggests that it may play a similar role with SARS-CoV-2, the virus responsible for COVID-19. [provided by RefSeq, Apr 2020] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN209466 | DPP4 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN209466BN | DPP4 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN209466LP | DPP4 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN209466RB | DPP4 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN409466 | DPP4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |