Human DHLAG (CD74) activation kit by CRISPRa
CAT#: GA100693
CD74 CRISPRa kit - CRISPR gene activation of human CD74 molecule
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 3600.00
CNY 800.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | CD74 |
Locus ID | 972 |
Kit Components | GA100693G1, DHLAG gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAATGTCCACTCCCTAGAC GA100693G2, DHLAG gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGATCCCATTGGCTGCCCA GA100693G3, DHLAG gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGGCCAGCACGATCCCAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_001025158, NM_001025159, NM_004355, NR_157074, NM_001364083, NM_001364084 |
Synonyms | DHLAG; HLADG; Ia-GAMMA; II |
Summary | The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN405824 | CD74 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |