Human Calumenin (CALU) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CALU
Locus ID	813
Kit Components	GA100566G1, Calumenin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAATCCGCTCCACGCAACT GA100566G2, Calumenin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGGAAAGCGCCACGTCCCC GA100566G3, Calumenin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTTAGACCAATGGCTACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001130674, NM_001199671, NM_001199672, NM_001199673, NM_001199674, NM_001219, NR_074086
Synonyms	FLJ90608
Summary	The product of this gene is a calcium-binding protein localized in the endoplasmic reticulum (ER) and it is involved in such ER functions as protein folding and sorting. This protein belongs to a family of multiple EF-hand proteins (CERC) that include reticulocalbin, ERC-55, and Cab45 and the product of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.