Human Calumenin (CALU) activation kit by CRISPRa
CAT#: GA100566
CALU CRISPRa kit - CRISPR gene activation of human calumenin
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | CALU |
| Locus ID | 813 |
| Kit Components | GA100566G1, Calumenin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAATCCGCTCCACGCAACT GA100566G2, Calumenin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGGAAAGCGCCACGTCCCC GA100566G3, Calumenin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTTAGACCAATGGCTACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001130674, NM_001199671, NM_001199672, NM_001199673, NM_001199674, NM_001219, NR_074086 |
| Synonyms | FLJ90608 |
| Summary | The product of this gene is a calcium-binding protein localized in the endoplasmic reticulum (ER) and it is involved in such ER functions as protein folding and sorting. This protein belongs to a family of multiple EF-hand proteins (CERC) that include reticulocalbin, ERC-55, and Cab45 and the product of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN200589 | CALU - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN200589BN | CALU - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN200589LP | CALU - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN200589RB | CALU - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN400589 | CALU - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
