Human CACNG1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CACNG1
Locus ID	786
Kit Components	GA100551G1, CACNG1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGAAATACCCCAGTGCGG GA100551G2, CACNG1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCGAGGACAGCTTCTGCTC GA100551G3, CACNG1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGGTGCCACGCCTGGAGAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000727
Synonyms	CACNLG
Summary	Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is part of skeletal muscle 1,4-dihydropyridine-sensitive calcium channels and is an integral membrane protein that plays a role in excitation-contraction coupling. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). [provided by RefSeq, Dec 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.