Human CACNA1A activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CACNA1A
Locus ID	773
Kit Components	GA100538G1, CACNA1A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTCCGGAGTGGGTGGACTG GA100538G2, CACNA1A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTCCTCCGAGGTCCGGGTC GA100538G3, CACNA1A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACGAAACCCAGGTCTGGGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000068, NM_001127221, NM_001127222, NM_001174080, NM_023035
Synonyms	APCA; BI; CACNL1A4; CAV2.1; EA2; FHM; HPCA; MHP; MHP1; SCA6
Summary	Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.