Human BAI1 (ADGRB1) activation kit by CRISPRa
CAT#: GA100394
ADGRB1 CRISPRa kit - CRISPR gene activation of human adhesion G protein-coupled receptor B1
CNY 12255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | ADGRB1 |
Locus ID | 575 |
Kit Components | GA100394G1, BAI1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGCAGAGAAGCCAAGAGTT GA100394G2, BAI1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGAGCAGGAACCCAACTCT GA100394G3, BAI1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGCATTACGGATTACATC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_001702 |
Synonyms | BAI1; GDAIF |
Summary | Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN424196 | BAI1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |