Human ATF3 activation kit by CRISPRa
CAT#: GA100326
ATF3 CRISPRa kit - CRISPR gene activation of human activating transcription factor 3
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 2400.00
CNY 3705.00
CNY 800.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | ATF3 |
Locus ID | 467 |
Kit Components | GA100326G1, ATF3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCACGGGAGAAAGCTGAGTG GA100326G2, ATF3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCGAAGGGAAGCCTCGGT GA100326G3, ATF3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCTTTGTGGGGCGGAGGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_001030287, NM_001040619, NM_001206484, NM_001206485, NM_001206486, NM_001206488, NM_001674, NM_004024 |
Synonyms | FLJ41705 |
Summary | This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN202897 | ATF3 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN202897BN | ATF3 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN202897LP | ATF3 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN202897RB | ATF3 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN402897 | ATF3 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |