Human Androgen Receptor (AR) activation kit by CRISPRa
CAT#: GA100263
AR CRISPRa kit - CRISPR gene activation of human androgen receptor
CNY 12255.00
| Cited in 1 publication. |
CNY 1999.00
CNY 2700.00
CNY 6720.00
CNY 9690.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | AR |
| Locus ID | 367 |
| Kit Components | GA100263G1, Androgen Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGCAACAGTTTGCGAGTC GA100263G2, Androgen Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGGGAGGGAAAAGGAGGT GA100263G3, Androgen Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGTGGGAAGGCAAGGAGGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_000044, NM_001011645, NM_001348061, NM_001348063, NM_001348064 |
| Synonyms | AIS; AR8; DHTR; HUMARA; HYSP1; KD; NR3C4; SBMA; SMAX1; TFM |
| Summary | The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017] |
Citations (1)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
Co-expression and clinical utility of AR-FL and AR splice variants AR-V3, AR-V7 and AR-V9 in prostate cancer
,null,
Biomarker Research
,PubMed ID 37016463
[AR]
|
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN415316 | AR - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
