Human Albumin (ALB) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ALB
Locus ID	213
Kit Components	GA100148G1, Albumin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTATAGGTAAAAGCACACT GA100148G2, Albumin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTAGCAATAGATGCAATTT GA100148G3, Albumin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTAAGCAAAGTATTTAGTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000477, N53869
Synonyms	HSA; PRO0883; PRO0903; PRO1341
Summary	This gene encodes the most abundant protein in human blood. This protein functions in the regulation of blood plasma colloid osmotic pressure and acts as a carrier protein for a wide range of endogenous molecules including hormones, fatty acids, and metabolites, as well as exogenous drugs. Additionally, this protein exhibits an esterase-like activity with broad substrate specificity. The encoded preproprotein is proteolytically processed to generate the mature protein. A peptide derived from this protein, EPI-X4, is an endogenous inhibitor of the CXCR4 chemokine receptor. [provided by RefSeq, Jul 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.