TADA3L (TADA3) (NM_001278270) Human Untagged Clone

CAT#: SC336086

TADA3 (untagged) - Human transcriptional adaptor 3 (TADA3), transcript variant 3



  "NM_001278270" in other vectors (2)

CNY 4090.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal TADA3L Antibody (C-term)
    • 400 ul

CNY 6160.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ADA3; hADA3; NGG1; STAF54; TADA3L
Vector pCMV6-Entry
Sequence Data
>SC336086 representing NM_001278270.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGTGAGTTGAAAGACTGCCCCTTGCAGTTCCACGACTTCAAGTCTGTGGATCACCTGAAGGTCTGT
CCCCGCTACACGGCAGTGCTGGCACGCTCTGAGGATGATGGCATCGGCATCGAGGAGCTGGACACCCTG
CAGCTGGAGCTGGAGACCCTGCTGTCTTCTGCCAGCCGGCGCCTGCGTGTGCTTGAGGCCGAAACCCAG
ATCCTCACCGACTGGCAGGATAAGAAAGGTGACAGACGATTCCTGAAGCTGGGTCGAGACCATGAACTT
GGAGCTCCCCCCAAACATGGGAAGCCCAAGAAGCAGAAACTGGAAGGGAAGGCAGGACATGGGCCGGGC
CCTGGCCCAGGACGGCCCAAATCCAAAAACCTTCAGCCCAAGATCCAGGAATATGAATTCACTGATGAC
CCTATCGACGTGCCACGGATCCCCAAAAATGATGCCCCCAACAGGTTCTGGGCTTCAGTGGAGCCCTAC
TGTGCTGACATCACCAGCGAGGAGGTCCGCACACTTGAGGAGTTACTGAAGCCCCCAGAAGATGAGGCT
GAGCATTACAAGATCCCACCCCTGGGGAAGCACTACTCCCAGCGCTGGGCCCAGGAGGACCTGCTGGAG
GAGCAGAAGGATGGGGCCCGGGCAGCGGCTGTGGCTGACAAGAAGAAAGGCCTCATGGGGCCACTGACC
GAACTGGACACTAAAGATGTGGATGCCCTGCTGAAGAAGTCTGAGGCCCAGCATGAACAGCCGGAAGAT
GGATGCCCCTTTGGTGCCCTGACGCAGCGCCTCCTGCAGGCCCTGGTGGAGGAAAATATTATTTCCCCT
ATGGAGGATTCTCCTATTCCTGACATGTCTGGGAAAGAATCAGGGGCTGACGGGGCAAGCACCTCCCCT
CGCAATCAGAACAAGCCCTTCAGTGTGCCGCATACTAAGTCCCTGGAGAGCCGCATCAAGGAGGAGCTA
ATTGCCCAGGGCCTTTTGGAGTCTGAGGACCGCCCCGCAGAGGACTCCGAGGATGAGGTCCTTGCTGAG
CTTCGCAAACGGCAGGCTGAGCTGAAGGCACTTAGTGCCCACAACCGCACCAAGAAGCACGACCTGCTG
AGGCTGGCAAAGGAGGAGGTGAGCCGGCAGGAGCTGAGGCAGCGGGTGCGCATGGCTGACAACGAGGTC
ATGGACGCCTTTCGCAAGATCATGGCTGCCCGGCAGAAGAAGCGGACTCCCACCAAGAAAGAAAAGGAC
CAGGCCTGGAAGACTCTGAAGGAGCGTGAGAGCATCCTGAAGCTGCTGGATGGGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001278270
Insert Size 1299 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278270.1
RefSeq Size 1924 bp
RefSeq ORF 1299 bp
Locus ID 10474
UniProt ID O75528
Protein Families Transcription Factors
MW 48.9 kDa
Gene Summary DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1 and 3 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...