PGAP4 (NM_001303108) Human Untagged Clone

CAT#: SC335897

TMEM246 (untagged) - Human transmembrane protein 246 (TMEM246), transcript variant 3



  "NM_001303108" in other vectors (2)

CNY 3800.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-TMEM246 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C9orf125; TMEM246
Vector pCMV6-Entry
Sequence Data
>SC335897 representing NM_001303108.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCACTTCAACCTCTCCAGCTGCCATGCTCCTCCGGAGGCTGCGGCGACTCTCCTGGGGCAGCACT
GCTGTCCAGCTCTTCATCCTAACAGTGGTGACGTTTGGCCTGCTGGCCCCCCTGGCCTGTCACCGACTT
CTACACTCTTACTTCTATCTGCGCCATTGGCATCTGAACCAAATGAGCCAAGAGTTCCTGCAGCAAAGC
TTGAAAGAGGGTGAGGCTGCCCTCCACTATTTTGAGGAGCTTCCCTCTGCCAATGGCTCAGTGCCCATT
GTCTGGCAGGCCACCCCCCGGCCCTGGCTGGTGATCACCATCATCACTGTGGACAGGCAGCCTGGCTTC
CACTACGTCCTGCAGGTTGTGTCCCAGTTCCACCGGCTTCTTCAGCAATGTGGCCCCCAGTGCGAGGGG
CACCAACTCTTCCTGTGCAACGTGGAGCGTAGTGTGAGCCATTTTGATGCCAAGTTGCTCTCCAAGTAT
GTCCCTGTGGCCAATCGCTATGAGGGCACTGAGGATGATTATGGTGATGACCCTTCGACCAACTCGTTT
GAGAAAGAGAAGCAGGACTATGTCTATTGCCTGGAGTCATCCCTGCAGACCTACAACCCAGACTACGTC
CTGATGGTAGAAGACGATGCTGTACCAGAAGAGCAGATCTTCCCAGTCTTGGAGCACCTTCTGCGGGCT
CGCTTCTCTGAGCCACATCTCAGAGATGCCCTTTATCTCAAGCTGTATCACCCCGAGAGGCTCCAGCAC
TACATCAATCCAGAGCCCATGCGGATCCTGGAATGGGTTGGTGTAGGCATGTTGCTGGGGCCCTTACTA
ACCTGGATATACATGAGGTTTGCCAGCCGCCCAGGGTTTAGCTGGCCTGTAATGCTCTTCTTCTCCCTG
TATAGCATGGGTCTGGTGGAGCTGGTGGGTCGGCACTATTTCCTGGAACTGCGGCGGCTGAGTCCTTCC
CTGTACAGTGTGGTTCCTGCCTCTCAGTGTTGCACCCCAGCCATGCTCTTCCCGGCACCTGCGGCCCGC
CGGACCCTCACCTACCTGTCCCAAGTGTACTGCCACAAGGGCTTTGGCAAGGACATGGCACTGTACTCG
CTGTTGAGGGCCAAGGGAGAGAGGGCCTATGTAGTGGAGCCGAACCTCGTGAAACACATCGGGCTCTTC
TCCAGTCTCCGGTACAACTTTCATCCCAGTCTCCTCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001303108
Insert Size 1212 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303108.1
RefSeq Size 4223 bp
RefSeq ORF 1212 bp
Locus ID 84302
UniProt ID Q9BRR3
Protein Families Transmembrane
MW 46.6 kDa
Gene Summary Golgi-resident glycosylphosphatidylinositol (GPI)-N-acetylgalactosamine transferase involved in the lipid remodeling steps of GPI-anchor maturation. Lipid remodeling steps consist in the generation of 2 saturated fatty chains at the sn-2 position of GPI-anchors proteins (PubMed:29374258). Required for the initial step of GPI-GalNAc biosynthesis, transfers GalNAc to GPI in the Golgi after fatty acid remodeling by PGAP2 (PubMed:29374258).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...