RMND5B (NM_001288794) Human Untagged Clone

CAT#: SC335832

RMND5B (untagged) - Human required for meiotic nuclear division 5 homolog B (S. cerevisiae) (RMND5B), transcript variant 1



  "NM_001288794" in other vectors (2)

CNY 3710.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RMND5B rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GID2; GID2B
Vector pCMV6-Entry
Sequence Data
>SC335832 representing NM_001288794.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCAGTGTGCGTGCGTGGAGAGAGAGCTGGACAAGGTCCTGCAGAAGTTCCTGACCTACGGGCAG
CACTGTGAGCGGAGCCTGGAGGAGCTGCTGCACTACGTGGGCCAGCTGCGGGCTGAGCTGGCCAGCGCA
GCCCTCCAGGGGACCCCTCTCTCAGCCACCCTCTCTCTGGTGATGTCACAGTGCTGCCGGAAGATCAAA
GATACGGTGCAGAAACTGGCTTCGGACCATAAGGACATTCACAGCAGTGTATCCCGAGTGGGCAAAGCC
ATTGACAGGAACTTCGACTCTGAGATCTGTGGTGTTGTGTCAGATGCGGTGTGGGACGCGCGGGAACAG
CAGCAGCAGATCCTGCAGATGGCCATCGTGGAACACCTGTATCAGCAGGGCATGCTCAGCGTGGCCGAG
GAGCTGTGCCAGGAATCAACGCTGAATGTGGACTTGGATTTCAAGCAGCCTTTCCTAGAGTTGAATCGA
ATCCTGGAAGCCCTGCACGAACAAGACCTGGGTCCTGCGTTGGAATGGGCCGTCTCCCACAGGCAGCGC
CTGCTGGAACTCAACAGCTCCCTGGAGTTCAAGCTGCACCGACTGCACTTCATCCGCCTCTTGGCAGGA
GGCCCCGCGAAGCAGCTGGAGGCCCTCAGCTATGCTCGGCACTTCCAGCCCTTTGCTCGGCTGCACCAG
CGGGAGATCCAGGTGATGATGGGCAGCCTGGTGTACCTGCGGCTGGGCTTGGAGAAGTCACCCTACTGC
CACCTGCTGGACAGCAGCCACTGGGCAGAGATCTGTGAGACCTTTACCCGGGACGCCTGTTCCCTGCTG
GGGCTTTCTGTGGAGTCCCCCCTTAGCGTCAGCTTTGCCTCTGGCTGTGTGGCGCTGCCTGTGTTGATG
AACATCAAGGCTGTGATTGAGCAGCGGCAGTGCACTGGGGTCTGGAATCACAAGGACGAGTTACCGATT
GAGATTGAACTAGGCATGAAGTGCTGGTACCACTCCGTGTTCGCTTGCCCCATCCTCCGCCAGCAGACG
TCAGATTCCAACCCTCCCATCAAGCTCATCTGTGGCCATGTTATCTCCCGAGATGCACTCAATAAGCTC
ATTAATGGAGGAAAGCTGAAGTGTCCCTACTGTCCCATGGAGCAGAACCCGGCAGATGGGAAACGCATC
ATATTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001288794
Insert Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288794.1
RefSeq Size 2124 bp
RefSeq ORF 1182 bp
Locus ID 64777
UniProt ID Q96G75
Protein Families Stem cell - Pluripotency
MW 44.4 kDa
Gene Summary Core component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1. MAEA and RMND5A are both required for catalytic activity of the CTLH E3 ubiquitin-protein ligase complex (PubMed:29911972). Catalytic activity of the complex is required for normal cell proliferation (PubMed:29911972). The CTLH E3 ubiquitin-protein ligase complex is not required for the degradation of enzymes involved in gluconeogenesis, such as FBP1 (PubMed:29911972).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 2 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...