CDC25B (NM_001287524) Human Untagged Clone

CAT#: SC335798

CDC25B (untagged) - Human cell division cycle 25B (CDC25B), transcript variant 10



  "NM_001287524" in other vectors (2)

CNY 3710.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CDC25B mouse monoclonal antibody,clone OTI6H9
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335798 representing NM_001287524.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGGATGGATTTGTCTTCAAGATGCCATGGAAGCCCACACATCCCAGCTCCACCCATGCTCTGGCA
GAGTGGGCCAGCCGCAGGGAAGCCTTTGCCCAGAGACCCAGCTCGGCCCCCGACCTGATGTGTCTCAGT
CCTGACCGGAAGATGGAAGTGGAGGAGCTCAGCCCCCTGGCCCTAGGTCGCTTCTCTCTGACCCCTGCA
GAGGGGGATACTGAGGAAGATGATGGATTTGTGGACATCCTAGAGAGTGACTTAAAGGATGATGATGCA
GTTCCCCCAGGCATGGAGAGTCTCATTAGTGCCCCACTGGTCAAGACCTTGGAAAAGGAAGAGGAAAAG
GACCTCGTCATGTACAGCAAGTGCCAGCGGCTCTTCCGCTCTCCGTCCATGCCCTGCAGCGTGATCCGG
CCCATCCTCAAGAGGCTGGAGCGGCCCCAGGACAGGGACACGCCCGTGCAGAATAAGCGGAGGCGGAGC
GTGACCCCTCCTGAGGAGCAGCAGGAGGCTGAGGAACCTAAAGCCCGCGTCCTCCGCTCAAAATCACTG
TGTCACGATGAGATCGAGAACCTCCTGGACAGTGACCACCGAGAGCTGATTGGAGATTACTCTAAGGCC
TTCCTCCTACAGACAGTAGACGGAAAGCACCAAGACCTCAAGTACATCTCACCAGAAACGATGGTGGCC
CTATTGACGGGCAAGTTCAGCAACATCGTGGATAAGTTTGTGATTGTAGACTGCAGATACCCCTATGAA
TATGAAGGCGGGCACATCAAGACTGCGGTGAACTTGCCCCTGGAACGCGACGCCGAGAGCTTCCTACTG
AAGAGCCCCATCGCGCCCTGTAGCCTGGACAAGAGAGTCATCCTCATTTTCCACTGTGAATTCTCATCT
GAGCGTGGGCCCCGCATGTGCCGTTTCATCAGGGAACGAGACCGTGCTGTCAACGACTACCCCAGCCTC
TACTACCCTGAGATGTATATCCTGAAAGGCGGCTACAAGGAGTTCTTCCCTCAGCACCCGAACTTCTGT
GAACCCCAGGACTACCGGCCCATGAACCACGAGGCCTTCAAGGATGAGCTAAAGACCTTCCGCCTCAAG
ACTCGCAGCTGGGCTGGGGAGCGGAGCCGGCGGGAGCTCTGTAGCCGGCTGCAGGACCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001287524
Insert Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001287524.1
RefSeq Size 2626 bp
RefSeq ORF 1167 bp
Locus ID 994
UniProt ID P30305
Protein Families Druggable Genome, Phosphatase
Protein Pathways Cell cycle, MAPK signaling pathway, Progesterone-mediated oocyte maturation
MW 45 kDa
Gene Summary CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (10) differs in the 5' UTR and has multiple coding region differences, compared to variant 1, which causes translation initiation at a downstream start codon. The resulting protein (isoform 9) has a shorter N-terminus and lacks an internal region compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...