GDF 9 (GDF9) (NM_001288828) Human Untagged Clone

CAT#: SC335644

GDF9 (untagged) - Human growth differentiation factor 9 (GDF9), transcript variant 6



  "NM_001288828" in other vectors (2)

CNY 3520.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-GDF9 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms POF14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335644 representing NM_001288828.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGAAGCTCTATAAGACATATGCTACCAAGGAAGGGATTCCTAAATCCAATAGAAGTCACCTCTAC
AACACTGTTCGGCTCTTCACCCCCTGTACCCGGCACAAGCAGGCTCCTGGAGACCAGGTAACAGGAATC
CTTCCATCAGTGGAACTGCTATTTAACCTGGATCGCATTACTACCGTTGAACACTTACTCAAGTCAGTC
TTGCTGTACAATATCAACAACTCAGTTTCTTTTTCCTCTGCTGTCAAATGTGTGTGCAATCTAATGATA
AAGGAGCCAAAGTCTTCTAGCAGGACTCTCGGCAGAGCTCCATACTCATTTACCTTTAACTCACAGTTT
GAATTTGGAAAGAAACACAAATGGATTCAGATTGATGTGACCAGCCTCCTTCAACCTTTAGTGGCCTCC
AACAAGAGAAGTATTCACATGTCTATAAATTTTACTTGCATGAAAGACCAGCTGGAGCATCCTTCAGCA
CAGAATGGTTTGTTTAACATGACTCTGGTGTCCCCCTCACTGATCTTATATTTGAATGACACAAGTGCT
CAGGCTTATCACAGCTGGTATTCCCTTCACTATAAAAGGAGGCCTTCCCAGGGTCCTGACCAGGAGAGA
AGTCTGTCTGCCTATCCTGTGGGAGAAGAGGCTGCTGAGGATGGGAGATCTTCCCATCACCGTCACCGC
AGAGGTCAGGAAACTGTCAGTTCTGAATTGAAGAAGCCCTTGGGCCCAGCTTCCTTCAATCTGAGTGAA
TACTTCAGACAATTTCTTCTTCCCCAAAATGAGTGTGAGCTCCATGACTTTAGACTTAGCTTTAGTCAG
CTGAAGTGGGACAACTGGATTGTGGCTCCGCACAGGTACAACCCTCGATACTGTAAAGGGGACTGTCCA
AGGGCAGTTGGACATCGGTATGGCTCTCCAGTTCACACCATGGTACAGAACATCATCTATGAGAAGCTG
GACTCCTCAGTGCCAAGACCGTCATGTGTACCTGCCAAATACAGCCCCTTGAGTGTTTTGACCATTGAG
CCCGATGGCTCAATTGCCTATAAAGAGTACGAAGATATGATAGCTACAAAGTGCACCTGTCGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001288828
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288828.2
RefSeq Size 1728 bp
RefSeq ORF 1101 bp
Locus ID 2661
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transmembrane
MW 41.8 kDa
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Reduced expression of this gene may be associated with polycystic ovary syndrome and mutations in this gene may be more common in mothers of dizygotic twins. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (6) contains two alternate exons in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 2, 3, 4, 5, and 6 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...