PHF7 (NM_001278221) Human Untagged Clone

CAT#: SC335483

PHF7 (untagged) - Human PHD finger protein 7 (PHF7), transcript variant 2



  "NM_001278221" in other vectors (2)

CNY 3330.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PHF7 mouse monoclonal antibody, clone OTI1G9 (formerly 1G9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSPC045; HSPC226; NYD-SP6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335483 representing NM_001278221.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGACTGTAAAAGAAAAGAAGGAATGCCAGAGATTGAGAAAATCTGCCAAGACTAGGAGGGTAACC
CAGAGGAAACCGTCTTCAGGGCCTGTTTGCTGGCTATGCCTTCGAGAACCTGGGGATCCCGAAAAATTA
GGGGAATTTCTTCAGAAAGACAATATCAGCGTGCATTATTTCTGTCTTATCTTATCTAGTAAGCTGCCT
CAGAGGGGCCAGTCCAACAGAGGCTTCCATGGATTTCTGCCTGAAGACATCAAAAAGGAGGCAGCCCGG
GCTTCTAGGAAGATCTGCTTTGTGTGCAAGAAAAAGGGAGCTGCTATCAACTGCCAGAAGGATCAGTGC
CTCAGAAACTTCCATCTGCCTTGTGGCCAAGAAAGGGGTTGCCTTTCACAATTTTTTGGAGAGTACAAA
TCATTTTGTGACAAACATCGCCCAACACAGAACATCCAACATGGGCATGTGGGGGAGGAAAGCTGCATC
TTATGTTGTGAAGACTTATCCCAACAGAGTGTTGAGAACATCCAGAGCCCGTGTTGTAGTCAAGCCATC
TACCACCGCAAGTGCATACAGAAATATGCCCACACATCAGCAAAGCATTTCTTCAAATGTCCACAGTGT
AACAATCGAAAAGAGTTTCCTCAAGAAATGCTGAGAATGGGAATTCATATTCCAGACAGGAGGTGGTGC
CTCATTCTGTGTGCTACATGCGGATCCCACGGAACCCACAGGGACTGCTCCTCTCTTAGATCTAACAGT
AAGAAATGGGAGTGTGAGGAGTGTTCACCTGCTGCAGCCACAGACTACATACCTGAAAACTCAGGGGAC
ATCCCTTGCTGCAGCAGCACCTTCCACCCTGAGGAACATTTCTGCAGAGACAACACCTTGGAAGAGAAT
CCGGGCCTTTCTTGGACTGATTGGCCAGAACCTTCCTTATTAGAAAAGCCAGAGTCCTCTCGTGGCAGG
AGGAGCTACTCCTGGAGGTCCAAGGGTGTCAGAATCACTAACAGCTGCAAAAAATCCAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278221
Insert Size 1029 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278221.2
RefSeq Size 2176 bp
RefSeq ORF 1029 bp
Locus ID 51533
UniProt ID Q9BWX1
Protein Families Druggable Genome, Transcription Factors
MW 39.3 kDa
Gene Summary Spermatogenesis is a complex process regulated by extracellular and intracellular factors as well as cellular interactions among interstitial cells of the testis, Sertoli cells, and germ cells. This gene is expressed in the testis in Sertoli cells but not germ cells. The protein encoded by this gene contains plant homeodomain (PHD) finger domains, also known as leukemia associated protein (LAP) domains, believed to be involved in transcriptional regulation. The protein, which localizes to the nucleus of transfected cells, has been implicated in the transcriptional regulation of spermatogenesis. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...