RAD52 (NM_001297421) Human Untagged Clone

CAT#: SC335479

RAD52 (untagged) - Human RAD52 homolog (S. cerevisiae) (RAD52), transcript variant 4



  "NM_001297421" in other vectors (2)

CNY 3330.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-RAD52 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335479 representing NM_001297421.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTGGTTACAATGGCTGGGCACACTCCATCACGCAGCAGAATGTGGATTTTGTTGACCTCAACAAT
GGCAAGTTCTACGTGGGAGTCTGTGCATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGAT
GTTGGTTATGGTGTTAGTGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCG
GTGACAGACGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAAA
GACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAACTAAAGCGAAG
AGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCGACCGAACATGGCCCTGGGA
CACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAGCCATGCTGTGATACCGGCGGACCAGGAC
TGCAGCTCCCGAAGCCTGAGCTCATCCGCCGTGGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAG
AAGCAGCTGCAGCAGCAGTTCCGGGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCT
GAGAAGAGTGAGGCAGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCA
CTCCTGGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTCTGAA
AAGTGGGCTGTGACTCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGCAGACCCAGCCCAG
ACCTCTGACACATTAGCCTTGAACAACCAGATGGTGACCCAGAACAGGACTCCACACAGCGTTTGCCAC
CAGAAACCACAAGCAAAATCTGGATCTTGGGACCTCCAAACTTATAGCGCTGACCAACGCACAACAGGA
AACTGGGAATCTCATAGGAAGAGCCAGGACATGAAGAAAAGGAAATATGATCCATCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001297421
Insert Size 1026 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001297421.1
RefSeq Size 2847 bp
RefSeq ORF 1026 bp
Locus ID 5893
Protein Families Druggable Genome
Protein Pathways Homologous recombination
MW 38 kDa
Gene Summary The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. The encoded isoform (c) has a shorter N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...